• Users Online: 523
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 
Table of Contents
RESEARCH ARTICLE
Year : 2017  |  Volume : 54  |  Issue : 2  |  Page : 146-150

Prevalence of Lassa virus among rodents trapped in three South-South States of Nigeria


1 Lahor Research Laboratories and Medical Centre, Benin City, Edo State; Department of Medical Laboratory Science, College of Health Sciences, Niger Delta University, Amassoma, Bayelsa State, Nigeria
2 Department of Medical Laboratory Science, Igbinedion University, Okada, Edo State, Nigeria
3 Department of Microbiology, Faculty of Life Sciences, University of Benin, Benin City, Edo State, Nigeria
4 Department of Medical Laboratory Science, Ambrose Alli University, Ekpoma, Edo State, Nigeria
5 Lahor Research Laboratories and Medical Centre, Benin City; Department of Medical Laboratory Science, Igbinedion University, Okada; Edo State, Nigeria
6 Department of Medical Laboratory Science, College of Health Sciences, Niger Delta University, Amassoma, Bayelsa State, Nigeria
7 Lahor Research Laboratories and Medical Centre, Benin City, Edo State, Nigeria
8 Department of Medical Laboratory Science, Ambrose Alli University, Ekpoma, Edo State, Nigeria, India

Date of Submission13-Mar-2017
Date of Acceptance12-May-2017
Date of Web Publication1-Sep-2017

Correspondence Address:
D E Agbonlahor
Department of Medical Laboratory Science, College of Health Sciences, Niger Delta University, Amassoma, Bayelsa State
Nigeria
Login to access the Email id

Source of Support: None, Conflict of Interest: None


PMID: 28748835

Rights and PermissionsRights and Permissions
  Abstract 


Background & objectives: Lassa fever has been endemic in Nigeria since 1969. The rodent Mastomys natalensis has been widely claimed to be the reservoir host of the Lassa virus. This study was designed to investigate the distribution of species of rodents in three states (Edo, Delta and Bayelsa) of Nigeria and to determine the prevalence of Lassa virus amongst trapped rodents in the selected states.
Methods: Rodents were trapped during November 2015 to October 2016 from the three states in South-South region of Nigeria. Total RNA was extracted from the blood collected from the trapped rodents. Reverse transcription polymerase chain reaction (RT-PCR) was used to confirm the presence of Lassa virus in the rodents.
Results: The results revealed that six species of rodents were predominantly present in these geographical locations. Mus musculus (39.4%) had the highest prevalence, closely followed by Rattus rattus (36.1%), R. fuscipus (20.3%), M. natalensis (2%), Myosoricinae soricidae (1.2%) and R. norvegicus (1%). The overall positivity (carrier rate) of Lassa virus was 1.6% amongst the 1500 rodents caught in the three states. In Edo and Delta States, the RT-PCR results showed presence of Lassa virus in R rattus, M. musculus and M. natalensis. On the other hand, only M. natalensis was detected with the virus, amongst the species of rodents caught in Bayelsa State. M. natalensis recorded the highest Lassa virus among rodents trapped in Edo (87%), Delta (50%) and Bayelsa (11%) States respectively.
Interpretation & conclusion: The rather low Lassa virus positive among rodents in Bayelsa State of Nigeria may explain the absence of reports of outbreak of Lassa fever over the past 48 yr in the state. The results also confirmed that apart from Mastomys natalensis, other rodents such as Rattus rattus and Mus musculus may also serve as reservoirs for Lassa virus. From the findings of this cross-sectional study, it was concluded that a more comprehensive study on rodents as reservoir host, need to be undertaken across the entire states of Nigeria, for better understanding of the epidemiology and endemicity of Lassa fever.

Keywords: Bayelsa; Delta; Edo; Lassa virus; Mastomys natalensis; Nigeria; rodent


How to cite this article:
Agbonlahor D E, Erah A, Agba I M, Oviasogie F E, Ehiaghe A F, Wankasi M, Eremwanarue O A, Ehiaghe I J, Ogbu E C, Iyen R I, Abbey S, Tatfeng M Y, Uhunmwangho J. Prevalence of Lassa virus among rodents trapped in three South-South States of Nigeria. J Vector Borne Dis 2017;54:146-50

How to cite this URL:
Agbonlahor D E, Erah A, Agba I M, Oviasogie F E, Ehiaghe A F, Wankasi M, Eremwanarue O A, Ehiaghe I J, Ogbu E C, Iyen R I, Abbey S, Tatfeng M Y, Uhunmwangho J. Prevalence of Lassa virus among rodents trapped in three South-South States of Nigeria. J Vector Borne Dis [serial online] 2017 [cited 2021 Nov 27];54:146-50. Available from: https://www.jvbd.org/text.asp?2017/54/2/146/211689




  Introduction Top


Lassa fever is a viral haemorrhagic fever that was first recorded in 1969 in the town of Lassa in the northeast of Nigeria[1]. It is endemic in the West African countries including Nigeria, Sierra Leone, Guinea and Liberia[2],[3]. It is caused by a single stranded RNA virus, which is a member of Arenavidae family and its primary natural host is the rodent, Mastomys natalensis, which live in close proximity to humans[4]. The infected Mastomys rodents drop urine/excreta containing the virus on floors and uncovered food items[4],[5]. The virus can be transmitted to humans through direct contact with infected materials[6].

The uncertainty about the precise natural host of Lassa virus is considered a major obstacle in the control of the disease. Although, Mastomys natalensis is majorly associated with the spread of Lassa virus[4],[5],[6], some reports suggest that other species of rodents could also be possible reservoir hosts for Lassa virus[7],[8]. Okoror et al[9] reported an incidence of 46.79% Lassa virus seroconversion in Mastomys natalensis among rodents trapped in a Lassa fever endemic village of Ekpoma in Edo State, Nigeria. Outbreaks of Lassa fever have been reported annually from different states of Nigeria including Edo and Delta States; however, it is not reported from Bayelsa[10]. This study was designed to investigate the distribution of rodent species in the above three States of Nigeria and also attempts were made to confirm the presence of Lassa virus amongst trapped rodents from these states.


  Material & Methods Top


Rodent trapping

Rodents were trapped during November 2015 to October 2016 from homes, neighbouring environments and dump sites, using cages, rat gums and local traps. A total of 1500 rodents were trapped from three states in South-South Region of Nigeria, viz. Edo, Delta and Bayelsa (500 rodents from each state). Two (Edo and Delta) of the selected are endemic for Lassa fever. Edo State divided into three senatorial districts (Edo North, Edo Central and Edo South). From Edo North (Auchi), 100 rodents were trapped, while 200 each were trappedfrom Edo Central (Ekpoma and Irrua) and Edo South (Benin and Okada) respectively. Delta State divided into three Senatorial district, viz. Delta North Senatorial District (DNSD), Delta Central Senatorial District (DCSD) and Delta South Senatorial District (DSSD). A total of 200 rodents were trapped from DNSD (Agbor) and DCSD (Efurrun), respectively while 100 rodents were trapped from DSSD (Oleh). Bayelsa State is also divided into three Senatorial districts (Bayelsa West, Bayelsa Central and Bayelsa East). A total of 200 rodents were captured from Bayelsa West (Sagbama and Ekeremor) and Bayelsa Central Senatorial Districts (Yanagoa and Amassoma) respectively while, 100 rodents were trapped from Bayelsa East Senatorial Districts (Ogbia and Otoeke).

Sample collection, preparation and rodents' phenotypic characterization

Blood was collected from the trapped rodents through cardiac puncture and was preserved at 4°C for total RNA extraction as described by Christine et al[11]. After blood collection, the rodents were preserved in 10% formal in for characterization. Morphological characteristics such as colour, length of rodent, length of tail and body weight were used to identify trapped rodents as described by Fichet-Hoch et al[12].

Polymerase chain reaction

RNA extraction: Total RNA was extracted using the whole-blood RNA Mini Prep (Zymo Research, Irvine, CA) as previously described by Ehiaghe et al[13]. A 70 μl of the extracted RNA was transferred into a RNA stable tube supplied by Biomatrica, Inc., San Diego (Catalog No. 93221-001) for storage at room temperature after proper drying.

Reverse transcriptase polymerase chain reaction (RT-PCR):

The extracted RNA was reverse-transcribed and amplified using one Taq one-step RT-PCR kit (catalog No. NEB E5315S), supplied by New England Bio Labs Incorporation (Massachusetts), according to the manufacturer’s specification. Forward and reverse primers (ATATAATGATGATGACTGTTGTTCTTTGTGCA; ACCGGGGATCCTAGGCATTT) were used to target Lassa virus glycoprotein complex template using Peltier thermal cycler PCR machine at the Lahor Research Laboratories, Benin City, Nigeria. The PCR was performed in a 50 μl reaction mixture containing 25 μl one Taq one-step reaction master mix (2×), 2 μl one Taq one-step enzyme mix (2×), 2 (μl of each gene-specific forward primer (10 (μM), 2 (μl of each gene-specific reverse primer (10 (μM), 9 μl of nuclease-free water and 10 μl of the RNA template was then added. The PCR was programmed as reverse transcription at 48°C for 30 min; initial denaturation at 94°C for 1 min; denaturation at 94°C for 15 sec, annealing at 55°C for 30 sec; and extension at 68°C for 1 min, repetition of the denaturation step for 39 cycles; final extension at 68°C for 5 min and final holding at 4°C. A total of 5 (μlof the amplified PCR products were analyzed on 1.5% agarose gel containing ethidium bromide in 1× Tris EDTA buffer. Electrophoresis was performed at 90 V for 30 min with the EDVOTEK tetra source electrophoresis machine, Bethesda, USA. The targeted genes were visualized using Wealtec (USA) Dolphin-Doc UV trans-illuminator and photographed. Molecular weights were calculated using molecular weight standard marker (100–1000 bp).

Ethical approval

The study was approved by the various local Governments health authorities in Edo, Delta and Bayelsa States. Ethical approval was also obtained from the Ethics Committee of Lahor Research Laboratories and Medical Centre, Benin City, Edo State, Nigeria with reference number LRL/005/034.


  Results Top


The overall distribution of rodent species found in the three states (Edo, Delta and Bayelsa) is shown in [Table 1]. In total six species of rodents were trapped, with M. musculus (39.4%) having the highest prevalence for Lassa virus, closely followed by R. rattus (36.1%), R. fuscipus (20.3%), M. natalensis (2%), Myosoricinae soricidae (1.2%) and R. norvegicus (1%). The [Table 2] summarizes a comparative data of distribution of rodent species in the study states according to their Lassa virus positivity. A total of rodent species were trapped in Edo State, whereas six species of rodents were trapped in Delta and Bayelsa States. Comparatively, R. rattus had the highest prevalence in the three states. The RT-PCR results were positive for R. rattus, M. musculus and M. natalensis in Edo and Delta State [Table 2] and [Figure 1]. Positive RT-PCR result was obtained only from M. natalensis rodent caught in Bayelsa State. Overall,M. natalensis was observed to be the most potent carrier of Lassa virus in Edo (87%), Delta (50%) and Bayelsa (11%) states respectively. This study also revealed an overall positivity of 1.6% for Lassa virus amongst the 1500 rodents trapped in the three states. The Edo State showed highest positive cases of Lassa virus with a prevalence of 3.4%, closely followed by Delta (1.2%) and Bayelsa State (0.2%).
Table 1: Overall frequency distribution of rodents according to presence of species and its abundance in the study states

Click here to view
Table 2: Distribution of rodent species and number of Lassa virus cases in the study states

Click here to view
Figure 1: Reverse transcriptase polymerase chain reaction results for Lassa virus analyzed with 1.5% agarose gel electrophoresis stained with ethidium bromide. L is 100–1200 bp DNA ladder (Molecular marker). Samples 2, 3, 4, 5, 6, 7, 9, 10 and 11 are positive for Lassa virus with band at 450 bp from Edo, Delta and Bayelsa States whereas, samples 1 and 8 are negative for Lassa virus.

Click here to view



  Discussion Top


The results of the study showed that six species of rodents are commonly found in Edo, Delta and Bayelsa States of Nigeria, with M. musculus (39.4%) having the highest prevalence of Lassa virus, closely followed by R. rattus (36.1%), R. fuscipus (20.3%), M. natalensis (2%),M. soricidae (1.2%) and R. norvegicus (1%). During the study, R. fuscipus was not found in the Edo State. This finding is in tandem with an earlier study conducted by Demby et al[14] and Keenlyside et al[15] wherein, their reported prevalence varied from of 0 to 9% in different places. According to them the prevalence of rodent species in Africa depends on the geographic location. In this study, the overall prevalence of positivity of Lassa virus was 1.6% amongst the 1500 trapped and studied rodents. Positive RT-PCR results for Lassa virus from M. natalensis were detected from the three states. In addition, Lassa virus was detected in R. rattus and M. musculus in Edo and Delta States, which suggests that other rodent species could be involved in the transmission of Lassa virus in this region. This is in conformity with earlier findings, which showed that other species of rodents might also serve as possible reservoir host for the maintenance and transmission Lassa virus[7],[8]. These findings might explain the endemicity, wide-spread nature and the perennial outbreaks of this 48-yr-old deadly disease in Nigeria. One such very devastating and widest spread outbreak of Lassa fever occurred in 2012 in Nigeria. The states affected were Edo, Delta, Ondo, Rivers, Ebonyi, Kano, Yobe, Benue, Kaduna, Kogi, Bauchi, Adamawa, Abia, Anambra, Imo States and the Federal Capital Territory, Abuja[10]. Earlier studies have shown that rodent population density influence the distribution and transmission of Lassa virus in varying geographic locations[16],[17],[18]. Proper identification and documentation of prevailing reservoir rodents should be an important pre-requisite in any meaningful effort aimed at controlling the menace of Lassa fever in an endemic nation such as Nigeria.

The M. natalensis species showed highest positivity (carrier rate) for Lassa virus in the present study. The positivity of Lassa virus was relatively low in rodents trapped in Bayelsa State. This might explain the reason behind less outbreaks of Lassa fever in Bayelsa State as compared to other states in Nigeria including Edo and Delta states[10]. The arenaviruses infect their respective rodent hosts either by vertical virus transmission (dam-to-progeny) or horizontal transmission, while fighting for the dominance or survival[19]. Eradication of arenaviruses is not a feasible goal because these pathogens (Lassa virus) are usually harboured by wild rodent population. However, if exposure of infected rodents can be reduced by avoiding rodent-human contact, the infection spread would drastically reduce[19]. Prevention is always better than cure; hence, it should be obligatory to consider the sustainable preventive strategies that would ensure the reduction of rodent-human contact through sustained Lassa fever enlightenment programme, prevention of rodents from entering homes, ensuring that all food items must remain properly covered in homes and those working with clinical specimens wear protective clothing (such as masks, gloves, gowns and goggles), and safeguarding that infected patients are isolated from unprotected persons until the disease completes its course. These measures are very important because outbreaks of Lassa fever in Nigeria between 1969 and 2016 has claimed over 100,000 lives and its still counting[10].


  Conclusion Top


Based on the study results it was concluded that apart from M. natalensis, other rodent species such as R. rattus and M. musculus may also serve as reservoirs for Lassa virus. Hence the nations, such as Nigeria, which are endemic to Lassa fever, should mandatorily put in place sustainable preventive strategies that would ensure the reduction of rodent-human contact.

Conflict of interest

The authors declare that they have no conflict of interests.


  Acknowledgements Top


The assistance and cooperation of the members of staff of the Lahor Research Laboratory, Benin City, Nigeria is acknowledged.



 
  References Top

1.
Frame JD, Baldwin JM, Gocke DJ, Troup JM. Lassa fever: A new virus disease of man from West Africa. Am J Trop Med Hyg 1970; 19(4): 670–6.  Back to cited text no. 1
    
2.
Bowen MD, Rollin PE, Ksiazek TG, Hustad HL, Bausch DG. Genetic diversity among Lassa virus strain. J Virol 2000; 74: 6992–7004.  Back to cited text no. 2
    
3.
Fichet-Calvet E, Roger DJ. Risk map of Lassa fever in West Africa. PloS Negl Trop Dis 2009; 3: 388–90.  Back to cited text no. 3
    
4.
Lecompte EE, Fichet-Calvet S, Daffis K, Koulemon Q, Sylla F, Kourouma A, et al. Mastomys natalensis and Lassa fever. Emerg Infect Dis 2006; 12: 1971–4.  Back to cited text no. 4
    
5.
Walker DH, Wulff H, Lange JV, Murphy H. Comparative pathology of Lassa virus infection in Monkeys, Guinea pigs, and Mastomys natalensis. Bull World Health Organ 1975; 52: 523–34.  Back to cited text no. 5
    
6.
Bausch DG, Demby A, Coulibaly M, Kanu J, Goba A, Bah A. Lassa fever in Guinea: Epidemiology of human disease and clinical observation. Vector Borne Zoonotic Dis 2001; 4: 269–81.  Back to cited text no. 6
    
7.
Granjon L, Duplantier JM, Catalan J, Britton-Davidian J. Systematic of the genus Mastomys. A review. Belg J Zool 1997; 127: 7–18.  Back to cited text no. 7
    
8.
Mills JN, Childs JE. Ecologic studies of rodents reservoirs: Their relevance for human health. Emerg Infect Dis 1998; 4: 529–37.  Back to cited text no. 8
    
9.
Okoror LE, Esumeh FI, Agbonlahor DE, Omolu PI. Lassa virus: Seroepidemiological survey of rodents caught in Ekpoma and environs. Trop Doctor 2005; 35: 16–7.  Back to cited text no. 9
    
10.
Weekly Epidemiology Report 2012. Nigeria: Centre for Disease Control, Federal Ministry of Health. Weekly Epidemiol Rep No. 2, 2012; p. 15.  Back to cited text no. 10
    
11.
Christine B, Adriana G, George K. Drawing blood from rats through the saphenous vein and by cardiac puncture. J Vis Exp 2007; 7: 266–8.  Back to cited text no. 11
    
12.
Fisher-Hoch SP, Hutwagner L, Brown B. Effective vaccine for Lassa fever. J Virol 2000; 74: 6777–83.  Back to cited text no. 12
    
13.
Ehiaghe FA, Onyenekwe CC, Akosile CO, Okoye C, Maruf FA, Agbonlahor DE, et al. The expression pattern and role of interferon gamma genes in exhaustive exercise. J Adv Bio 2016; 9: 1903–10.  Back to cited text no. 13
    
14.
Demby AH, Inapogui A, Kargbo K, Koninga J, Kourouma K, Kanu J. Lassa fever in Guinea: Distribution and prevalence of Lassa virus infection in small mammals. Vector Borne Zoonotic Dis 2001; 1: 283–96.  Back to cited text no. 14
    
15.
Keenlyside RA, McCormick JB, Webb PA. Case-control study of Mastomys natalensis and human in Lassa virus-infected households in Sierra Leone. Am J Trop Med Hyg 1983; 32: 829–37.  Back to cited text no. 15
    
16.
Michele TJ, Carol G, Charles FF. Zoonosis Update: The arenaviruses. JAVMA 2005; 227: 904–15.  Back to cited text no. 16
    
17.
Lecompte E, Fichet-Calvet E, Daffis S, Koulemou K, Sylla O. Mastomys natalensis and Lassa fever, West Africa. Emerg Infect Dis 2006; 12: 1971–4.  Back to cited text no. 17
    
18.
Solen K, Lamine K, N’Faly M, Kekoura K, Rosamund Lewis, Aristide A, et al. Prevalence and risk factors of Lassa seropositivity in inhabitants of the forest region of Guinea: A cross sectional study. PLoS Negl Trop Dis 2009; 11: 548–51.  Back to cited text no. 18
    
19.
Childs JE, Peters CJ. ecology and Epidemiology of arenaviruses and their hosts. In: Salvato MS, editor. The Arenaviridae. New York: Plenum Press 1993; p. 331–84.  Back to cited text no. 19
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Material & Methods
Results
Discussion
Conclusion
Acknowledgements
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed1812    
    Printed55    
    Emailed0    
    PDF Downloaded497    
    Comments [Add]    

Recommend this journal