Journal of Vector Borne Diseases

RESEARCH ARTICLE
Year
: 2020  |  Volume : 57  |  Issue : 1  |  Page : 37--39

Detection of West Nile virus by real-time PCR in crows in northern provinces of Iran


Mojtaba Sharti1, Mohammad Javad Amouakbari1, Keyvan Pourjabari1, Mohammad Sadegh Hashemzadeh1, Mahdi Tat1, Abolfazl Omidifar2, Ruhollah Dorostkar1,  
1 Applied Virology Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran
2 Students Research Committee, School of Allied Medical Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran

Correspondence Address:
Dr Ruhollah Dorostkar
Applied Virology Research Center, Baqiyatallah University of Medical Sciences, Tehran
Iran

Abstract

Background & objectives: West Nile virus (WNV) is a positive-sense, single-stranded RNA virion, that belongs to the Flaviviridae family. This virus is preserved in a bird-mosquito cycle that is capable of inducing diseases as a dead-end or endpoint host in humans as well as horses. In 2016, a suspicious case of crow population death was reported by the Department of Environment, Ministry of Health, Iran. Considering the mass migration of birds together with the WNV-related symptoms, including uncoordinated walking, ataxia, inability to fly, lack of awareness, and abnormal body posture, it was necessary to further investigate the possible causes of this incident. The objective of this study was molecular detection of WNV in crows utilizing the real-time PCR method in the northern provinces of Iran. Methods: A total of 12 crows (8 dead, 4 alive) with a possible WNV infection, were collected from the northern provinces of Iran (Golestan, Mazandaran, and Guilan). A tissue sample of the liver, kidney, or lung was collected from all the crows, and RNA was isolated using an RNA extraction kit. A one-step real-time PCR method using a TaqMan probe was used for virus detection. Results: All the infected crows were positive for WNV. The 132-bp real-time PCR amplicon of the genome was detected in all the samples. Comparative phylogenetic analysis revealed that WNV isolated from Iran clustered with strains from the USA, Hungary, and Culex pipiens. Interpretation & conclusion: The WNV genome sequence was detected in all the infected crows. The results confirmed the connection of this isolation with clade1a strains. Hence, determining the epidemiologic and prevalence characteristics of the WNV for transmission control is of critical importance in Iran.



How to cite this article:
Sharti M, Amouakbari MJ, Pourjabari K, Hashemzadeh MS, Tat M, Omidifar A, Dorostkar R. Detection of West Nile virus by real-time PCR in crows in northern provinces of Iran.J Vector Borne Dis 2020;57:37-39


How to cite this URL:
Sharti M, Amouakbari MJ, Pourjabari K, Hashemzadeh MS, Tat M, Omidifar A, Dorostkar R. Detection of West Nile virus by real-time PCR in crows in northern provinces of Iran. J Vector Borne Dis [serial online] 2020 [cited 2021 Apr 17 ];57:37-39
Available from: https://www.jvbd.org/text.asp?2020/57/1/37/308797


Full Text

 Introduction



West Nile virus (WNV) is an enveloped, spherical, positive-sense single-stranded RNA virion, that belongs to the Flaviviridae family (genus Flavivirus). This virus is preserved in a bird-mosquito cycle that is capable of inducing diseases as a dead-end or endpoint host in humans as well as horses[1]. Incidence and prevalence of this virus were first recorded in the West Nile region of Uganda which was isolated from a female patient[2]. Birds are considered as initial booster hosts to WNV, and in nature, the virus is retained both horizontally and vertically via mosquito-bird-mosquito transmission cycle. The WNV stricken birds show symptoms, including uncoordinated walking, ataxia, weakness, tremors, inability to fly, blindness, lack of awareness, head droop, and abnormal body posture. The virus has a vast geographical distribution, with traces in most regions of the world, including Africa, Israel, South America, the Middle East, and parts of Asia[3]. Due to its large outspread, it is considered one of the most pervasive arboviruses in the world. Since its discovery in the West Nile region, the high prevalence and mortality rate of the virus is evident in the reports citing WNV as the most common cause of human morbidity and mortality in the 1970s and 1980s[4]. Various articles have shown a potential relationship between avian and human mortality rate. This implies, by controlling and monitoring virus spread in avian populations, human incidence can likely be reduced[5],[6].

Because of its diverse climates, and numerous lakes and wetlands, Iran serves as a migratory destination for various species of birds in different seasons. Monitoring and surveillance of these birds as a precautious action to prevent epidemic and fatal diseases poses a great challenge for public health authorities. In 2016, preliminary reports on suspicious deaths of the crow population were released by the Department of Environment, Ministry of Health. The high mortality rate in the crow population in the northern cities of Iran had caused environmental issues. To figure out the cause of the deaths amid observing WNV symptoms, a molecular investigation was carried out. In this study, we aimed to detect the WNV in the collected crows’ population using real-time PCR and to assess the WNV occurrence rate.

 Meterial & Methods



With regards to WNV-related symptoms including uncoordinated walking, weakness, inability to fly, blindness, lack of awareness, and head droop in the crow population, a total of 12 crows (8 dead and 4 alive) with a possible WNV infection, were collected from the northern provinces of Iran (Golestan, Mazandaran, and Guilan). The crows which were collected as alive were killed and samples from various tissues such as kidney, liver or lungs were extracted (approximately 0.5 cm3). The tissues then were crushed with a pestle and mortar and subsequently frozen and thawed. Tissues were later homogenized by grinding each piece in a 2.0 ml BA1 medium containing 20% fetal bovine serum and antibiotics. The homogenates were clarified at 8000 rpm for 5 min, and 100 ml of supernatant was inoculated Vero cell monolayers (African green monkey). The cells were incubated at 37°C in fetal bovine serum, 5% CO2 atmosphere, and observed for 3–7 days for the development of cytopathic effects (CPEs) by applying an inverted microscope. The cultures with CPEs were confirmed in all the samples and all infected crows were positive. For molecular detection of WNV, RNA was isolated from 100 μl of virus-rich supernatant by using the RNA extraction kit, QIAamp viral RNA Mini Kit (Qiagen, USA,) according to the manufacturer’s instructions. A real-time PCR method using a TaqMan probe, one-step PCR was applied (Rotor-Gene 6000 instrument, Corbett Research, Australia). Primers and probes were specific to WNV and purchased from M/s Vivantis Technologies Corporation (Cat No. R27809, Malaysia). The FORWARD and REVERSE and probe sequence were GTAGTATTTAGTGGTGTTAGTGTAAA TAGTTAAG, GCAGCACCGTCTACTCAACTTC, and FAM-AGGAGAAAGTCAGGCCGGGAAGTTC-BHQ, respectively with a 132 bp of amplicon size. The RT-PCR condition was as described below: 60 min at 50°C, followed by 45 cycles of PCR (1 min at 95°C, 30 sec at 60°C, 20 sec at 72°C, with final extension for 7 min at 72°C and hold at 4°C). In order to validate the results, the PCR amplicon was sent to M/s Macrogen Inc, Korea for sequencing analysis.

Amplified sequences (132 bp) were aligned against reference sequences retrieved from the NCBI (accession number) by CLC main workbench 5.5. A phylogenetic tree was constructed using the neighbour-joining method with 1000 bootstraps, as implemented in MEGA 5 software.

 Results



All the infected crows were positive for the WNV. The 132-bp PCR amplicon of the genome was detected in all the samples. As shown in [Figure 1], comparative phylogenetic analysis revealed that WNV isolated from Iran clustered with strains from the USA, Hungary, and Culex pipiens. Also, results confirmed the connection of this isolation with clade1a strains, as described earlier[7].{Figure 1}

 Discussion



The WNV is a mosquito-borne zoonotic pathogen virus transmitted to humans and horses as end-point hosts and has prevalence throughout temperate and tropical areas of the world. Numerous studies have reported that migrant birds have a greater ability to transmit WNV and can be considered as “reservoir hosts”. It is estimated that roughly 158 bird species are involved in the transmission cycle, and WNV-related mortality reported in birds in different regions such as Europe, Israel and North America. Birds are one of the main reservoir hosts for WNV. The virus is capable of inducing itself on 111 different species. Once infected, high titre viremia of the virus is produced in birds which is the key to the transmission of WNV to mosquitoes. It seems that the passerine family of Passeriformes, namely finches, blackbirds, jays, crows, sparrows and warblers as a result of high viremia, are playing a critical role in preserving the virus in nature. Corvidae family (crows, blue jays) carry this burden even further. Among all, because of their efficient production of serum viremia, the passerine family of birds has a greater potential in infecting mosquitoes and thus are classified as “amplifier hosts”[8].

Due to climate diversity and wetlands and the presence of migrant birds, Iran has potentially ideal conditions for spreading WNV. To date, there are few studies examining the virus in humans, birds and horses, and only one study gives accounts of epidemiology and etiology of the virus in the avian population (as the main amplifier host). In Iran, Saidi[9] showed specific antibodies against WNV in healthy human females for the first time. In 2009, a study that was performed in 1054 equine sera samples showed a high rate of seroprevalence of WNV and the seropositivity was mostly detectable in the southwest and northern parts of Iran[10].

According to the national surveillance system of arboviruses and viral haemorrhagic fevers, Iran, although various serologic studies have investigated the prevalence of the virus in different Iranian populations, only limited studies have considered quantitative prevalence among birds (as the main amplifier host), especially in crow populations[11]. Considering the recent outbreaks of the virus in neighbouring countries like Afghanistan and Pakistan on one hand and avian migration from these countries to Iran, studies focusing on the epidemiologic and prevalence of the virus in Iran is of critical importance[12].

 Conclusion



The WNV genome sequence was detected in all the infected crows collected from the study areas. The results confirmed the connection of this isolation with clade 1a strains. Hence, determining the epidemiologic and prevalence characteristics of the WNV and bringing its transmission under control in Iran, is of critical importance. Moreover, regarding the mysterious case of the mass death of crows, this study could help to cement the WNV role theory.

Conflict of interest

There are no conflict of interests to declare.

References

1Kramer LD, Li J, Shi PY. West Nile virus. Lancet Neurol 2007; 6(2): 171–81.
2Benjelloun A, El Harrak M, Belkadi B. West Nile disease epidemiology in North-West Africa: Bibliographical review. Transbound Emerg Dis 2016; 63(6): e153–9.
3Hayes EB, Sejvar JJ, Zaki SR, Lanciotti RS, Bode AV, Campbell GL. Virology, pathology, and clinical manifestations of West Nile virus disease. Emerg Infect Dis 2005; 11(8): 1174–9.
4Sotelo E, Gutierrez-Guzmán AV, Del Amo J, Llorente F, El-Harrak M, Pérez-Ramírez E, et al. Pathogenicity of two recent Western Mediterranean West Nile virus isolates in a wild bird species indigenous to Southern Europe: The red-legged partridge. Vet Res 2011; 42(11): 1–8.
5John HR, Scott RD, Zdenek H. Migratory birds and spread of West Nile virus in the Western Hemisphere. Emerg Infect Dis 2000; 6(4): 319.
6Ciota AT, Kramer LD. Vector-virus interactions and transmission dynamics of West Nile virus. Viruses 2013; 5(12): 3021–47.
7Lanciotti RS, Ebel GD, Deubel V, Kerst AJ, Murri S, Meyer R, et al. Complete genome sequences and phylogenetic analysis of West Nile virus strains isolated from the United States, Europe, and the Middle East. Virology 2002; 298(1): 96–105.
8Sambri V, Capobianchi M, Harrell R, Fyodorova M, Gaibani P, Gould E, et al. West Nile virus in Europe: Emergence, epidemiology, diagnosis, treatment, and prevention. Clin Microbiol Infect 2013; 19(8): 699–704.
9Saidi S. Viral antibodies in preschool children from the Caspian area, Iran. Iranian J Public Health 1974; 3(2): 83–91.
10Ahmadnejad F, Otarod V, H Fallah M, Lowenski S, Sedighi-Moghaddam R, Zavareh A, et al. Spread of West Nile virus in Iran: A cross-sectional serosurvey in equines, 2008–2009. Epidemiol Infect 2011; 139(10): 1587–93.
11Fereidouni SR, Ziegler U, Linke S, Niedrig M, Modirrousta H, Hoffmann B, et al. West Nile virus monitoring in migrating and resident water birds in Iran: Are common coots the main reservoirs of the virus in Wetlands? Vector Borne Zoonotic Dis 2011; 11(10): 1377–81.
12Zohaib A, Saqib M, Beck C, Hussain MH, Lowenski S, Lecollinet S, et al. High prevalence of West Nile virus in equines from the two provinces of Pakistan. Epidemiol Infect 2014; 143(9): 1931–5.